recombinant cas9 (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
96
Structured Review
New England Biolabs
recombinant cas9
Recombinant Cas9, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1578 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/s+pyogenes/Cas9+Nuclease%2C+S%2E+pyogenes/pm42031757-310-0-6
Average 96 stars, based on 1578 article reviews
Recombinant Cas9, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1578 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/s+pyogenes/Cas9+Nuclease%2C+S%2E+pyogenes/pm42031757-310-0-6
Average 96 stars, based on 1578 article reviews
recombinant cas9 - by Bioz Stars,
2026-09
96/100 stars
Images
Related Articles
Sequencing:Article Title: CRISPR/Cas9-mediated gene targeting at BBM2 locus demonstrates HDR-assisted precise knock-in in banana cv. Grand Naine. Article Snippet: Key message The present study demonstrates the first CRISPR/Cas-mediated precise knock-in of the eGFP gene at the BABYBOOM2 (GN-BBM2) locus in banana cv.. Grand Naine, facilitating the detection of editing events in early embryogenic developmental stages.. Abstract Genome editing has accelerated crop improvement programs by introducing targeted and precise genetic modifications. Article Title: CHK1 is an integral regulator of DNA replication in human cells Article Snippet: All primers were synthesized by Integrated DNA Technologies. .. For in vitro synthesis of sgRNAs, a DNA template containing a T7 promoter, a 20-nt guide sequence (CHK1-N-gRNA2: AGTGCCCTTTGTGGAAGACT), and the sgRNA scaffold was generated by overlapping PCR. sgRNAs were synthesized using the EnGen® sgRNA Synthesis Kit, Article Title: CHK1 is an integral regulator of DNA replication in human cells. Article Snippet: All primers were synthesized by Integrated DNA Technologies. .. For in vitro synthesis of sgRNAs, a DNA template containing a T7 promoter, a 20-nt guide sequence (CHK1-N-gRNA2: AGTGCCCTTTGTGGAAGACT), and the sgRNA scaffold was generated by overlapping PCR. sgRNAs were synthesized using the EnGen® sgRNA Synthesis Kit, Article Title: Comparison of the Differing Impacts of Lowered N-Acetylglucosaminyltransferase-Ia/b Activity on Motor and Sensory Function in Zebrafish Article Snippet: .. The target sequence was designed with a T7 promoter sequence added to the 5′ end of the target sequence, as well as a 14 nucleotide overlap sequence to the 3′ end, for use with the EnGen ® sgRNA Synthesis Kit, In Vitro:Article Title: CHK1 is an integral regulator of DNA replication in human cells Article Snippet: All primers were synthesized by Integrated DNA Technologies. .. For in vitro synthesis of sgRNAs, a DNA template containing a T7 promoter, a 20-nt guide sequence (CHK1-N-gRNA2: AGTGCCCTTTGTGGAAGACT), and the sgRNA scaffold was generated by overlapping PCR. sgRNAs were synthesized using the EnGen® sgRNA Synthesis Kit, Article Title: CHK1 is an integral regulator of DNA replication in human cells. Article Snippet: All primers were synthesized by Integrated DNA Technologies. .. For in vitro synthesis of sgRNAs, a DNA template containing a T7 promoter, a 20-nt guide sequence (CHK1-N-gRNA2: AGTGCCCTTTGTGGAAGACT), and the sgRNA scaffold was generated by overlapping PCR. sgRNAs were synthesized using the EnGen® sgRNA Synthesis Kit, Generated:Article Title: CHK1 is an integral regulator of DNA replication in human cells Article Snippet: All primers were synthesized by Integrated DNA Technologies. .. For in vitro synthesis of sgRNAs, a DNA template containing a T7 promoter, a 20-nt guide sequence (CHK1-N-gRNA2: AGTGCCCTTTGTGGAAGACT), and the sgRNA scaffold was generated by overlapping PCR. sgRNAs were synthesized using the EnGen® sgRNA Synthesis Kit, Article Title: CHK1 is an integral regulator of DNA replication in human cells. Article Snippet: All primers were synthesized by Integrated DNA Technologies. .. For in vitro synthesis of sgRNAs, a DNA template containing a T7 promoter, a 20-nt guide sequence (CHK1-N-gRNA2: AGTGCCCTTTGTGGAAGACT), and the sgRNA scaffold was generated by overlapping PCR. sgRNAs were synthesized using the EnGen® sgRNA Synthesis Kit, Polymerase Chain Reaction:Article Title: CHK1 is an integral regulator of DNA replication in human cells Article Snippet: All primers were synthesized by Integrated DNA Technologies. .. For in vitro synthesis of sgRNAs, a DNA template containing a T7 promoter, a 20-nt guide sequence (CHK1-N-gRNA2: AGTGCCCTTTGTGGAAGACT), and the sgRNA scaffold was generated by overlapping PCR. sgRNAs were synthesized using the EnGen® sgRNA Synthesis Kit, Article Title: CHK1 is an integral regulator of DNA replication in human cells. Article Snippet: All primers were synthesized by Integrated DNA Technologies. .. For in vitro synthesis of sgRNAs, a DNA template containing a T7 promoter, a 20-nt guide sequence (CHK1-N-gRNA2: AGTGCCCTTTGTGGAAGACT), and the sgRNA scaffold was generated by overlapping PCR. sgRNAs were synthesized using the EnGen® sgRNA Synthesis Kit, Synthesized:Article Title: CHK1 is an integral regulator of DNA replication in human cells Article Snippet: All primers were synthesized by Integrated DNA Technologies. .. For in vitro synthesis of sgRNAs, a DNA template containing a T7 promoter, a 20-nt guide sequence (CHK1-N-gRNA2: AGTGCCCTTTGTGGAAGACT), and the sgRNA scaffold was generated by overlapping PCR. sgRNAs were synthesized using the EnGen® sgRNA Synthesis Kit, Article Title: CHK1 is an integral regulator of DNA replication in human cells. Article Snippet: All primers were synthesized by Integrated DNA Technologies. .. For in vitro synthesis of sgRNAs, a DNA template containing a T7 promoter, a 20-nt guide sequence (CHK1-N-gRNA2: AGTGCCCTTTGTGGAAGACT), and the sgRNA scaffold was generated by overlapping PCR. sgRNAs were synthesized using the EnGen® sgRNA Synthesis Kit, Article Title: Seizures, increased interhemispheric synchrony, altered brain transcriptomics and a leaky blood-brain barrier result from loss of ap3b2 in a CRISPR tadpole model of DEE48 Article Snippet: .. Oligonucleotides were synthesized by IDT and used with the EnGen sgRNA Synthesis Kit, Purification:Article Title: Comparison of the Differing Impacts of Lowered N-Acetylglucosaminyltransferase-Ia/b Activity on Motor and Sensory Function in Zebrafish Article Snippet: .. The target sequence was designed with a T7 promoter sequence added to the 5′ end of the target sequence, as well as a 14 nucleotide overlap sequence to the 3′ end, for use with the EnGen ® sgRNA Synthesis Kit, |